Journal of Environmental Science International
[ ORIGINAL ARTICLE ]
Journal of Environmental Science International - Vol. 34, No. 8, pp.465-483
ISSN: 1225-4517 (Print) 2287-3503 (Online)
Print publication date 31 Aug 2025
Received 01 Jul 2025 Revised 22 Jul 2025 Accepted 23 Jul 2025
DOI: https://doi.org/10.5322/JESI.2025.34.8.465

Transcriptomic Analysis Reveals the Molecular Events in Aspergillus niger under High Aspect Ratio Vessel Simulated Microgravity

Yesupatham Sathishkumar1) ; Yang Soo Lee1) ; Sunirmal Sheet1), 2), *
1)Department of Wood Science and Technology, College of Agriculture and Life Sciences, Chonbuk National University, Jeonju 54896, Korea
2)Animal Genomics and Bioinformatics Division, National Institute of Animal Science, RDA, Wanju 55365, Korea

Correspondence to: *Sunirmal Sheet, Department of Wood Science and Technology, College of Agriculture and Life Sciences, Chonbuk National University, Jeonju 54896, Korea Phone:+82-63-270-2622 E-mail: sunirmal123@korea.kr

Ⓒ The Korean Environmental Sciences Society. All rights reserved.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Aspergillus niger is known as a common contaminant in space station environments. It has been used as a model fungus for studying enzyme production in eukaryotes. In this study, a reference-based RNA-sequencing transcriptomic analysis was conducted to examine the biological response of A. niger under simulated microgravity conditions. Assuming that microgravity represents a distinctive environmental stimulus, understanding its effects on fungal behavior is crucial, predominantly in the context of astronaut health and biotechnological applications. Environmental factors such as low pressure and low temperature are known to influence enzyme production in A. niger. Therefore, genes encoding industrially relevant enzymes were screened for differential expression to assess the impact of simulated microgravity. Remarkably, a significant upregulation of enzyme-coding genes was observed at 12 h of incubation under microgravity, with sustained expression through 48 h. Annotation against a reference database and differential expression analysis using DESeq revealed an increase in secondary metabolite genes expression under simulated microgravity compared to normal gravity conditions. However, our result showed that A. niger did not exhibit upregulation of genes associated with pathogenicity. These results suggested that A. niger responded to microgravity by enhancing metabolite synthesis while maintaining a reduced virulence profile. Finally, these findings of fungal adaptation can give some insight for both space health management and industrial enzyme production in extraterrestrial environments.

Keywords:

Aspergilus niger, Transcriptomic analysis, RNA-sequencing, Simulated microgravity, High aspect ratio vessel

1. Introduction

The space environment imposes unique physical stresses on microorganisms, influencing their physiology, metabolite production, and virulence properties (Yesupatham, 2015; Zhang et al., 2015). Various microbial groups-including green algae (Scalzi et al., 2012), cyanobacteria (Stöffler et al., 2007), lichens (Onofri et al., 2008), and fungi (Makimura et al., 2001) have demonstrated survival in microgravity (Yesupatham, 2015). Among them, fungi are of specific concern due to their supremacy in spacecraft microbial populations and their potential to damage hardware materials (Novikova, 2004). Furthermore, fungi can express stress-related proteins that enhance their survivability under extreme conditions (Tesei et al., 2012).

Filamentous fungi, including Aspergillus niger, are known to grow and produce secondary metabolites under microgravity (Sathishkumar et al., 2014; Kumar, 2015). This has significant implications for space missions, especially considering the role of microbes in bioregenerative life support systems, spacecraft contamination, and astronaut health (Horneck et al., 2010). A. niger is a widely studied filamentous fungus valued for its industrial production of citric acid, gluconic acid, and enzymes (Schuster et al., 2002). It thrives in a wide range of temperatures (6-47°C) and pH (1.4-9.8), making it resilient in diverse environments. However, under immunocompromised conditions, such as those experienced by astronauts, A. niger may act as an opportunistic pathogen (Taylor et al., 1996), causing diseases like aspergillosis and pulmonary oxalosis (Cahill et al., 1967; Metzger et al., 1984).

A. niger can also produce several mycotoxins, including ochratoxin A, fumonisin B2, malformin C, and naphtho-γ-pyrones (Isogai et al., 1975; Frisvad et al., 2007, Yesupatham, 2015), necessitating careful assessment of its behavior in space environments. Notably, microgravity can modulate microbial physiology by altering hydrostatic pressure, convection, and sedimentation processes, thereby impacting cell signaling and morphology (Vunjak-Novakovic et al., 2002; Morabito et al., 2015).

Due to the practical limitations of conducting experiments in real space, ground-based models such as clinorotation, magnetic levitation, and random positioning machines have been used to simulate microgravity (Kraft et al., 2000; Brown et al., 2002). In this study, we employed a High Aspect Ratio Vessel (HARV), a rotating bioreactor developed by NASA, to simulate microgravity. HARV maintains fungal spores in a continuous free-fall state, minimizing shear and sedimentation, thus mimicking microgravity-like conditions (Morabito et al., 2015).

Microgravity has been shown to enhance biofilm formation and stress protein production in various microbes, such as Micrococcus luteus and Salmonella typhimurium (Mauclaire et al., 2010; Jennings et al., 2011). Similarly, it increases quorum sensing molecule production in Rhodospirillum rubrum (Mastroleo et al., 2013). Given these unique responses, it is important to understand how A. niger responds to microgravity, particularly with respect to its metabolic activity and potential virulence.

To explore this, we performed a reference-based transcriptomic analysis using RNA-sequencing. Transcriptomics offers a high-resolution view of gene expression changes and allows the identification of key pathways involved in environmental adaptation, metabolism, and potential pathogenicity (Bhadauria et al., 2007; Wang et al., 2009). Leveraging expanded gene databases related to pathogenicity and stress response (Breakspear et al., 2007), current study aims to reveal the underlying molecular mechanisms of A. niger’s response to simulated microgravity, with suggestions for space health and industrial biotechnology (Yesupatham, 2015).


2. Materials and Methods

2.1. Fungal strain

Aspergillus niger strain KACC 42589 was obtained from the Korean Agricultural Culture Collection (Suwon, South Korea). The strain was maintained on Potato Dextrose Agar (BD Difco, MD, USA) supplemented with streptomycin antibiotics (100 mg L⁻¹) (Yesupatham, 2015). Approximately 10³ spores from a 7-day-old culture were inoculated into the HARV and incubated under experimental conditions. Mycelial samples were harvested and snap-frozen in liquid nitrogen for RNA extraction.

2.2. High Aspect Ratio Vessel (HARV)

A 50 mL autoclavable HARV was procured from Synthecon Inc. (Texas, USA). The vessel was operated in a controlled chamber maintained at 25°C and 90% relative humidity to prevent bubble formation. The vessel was filled with culture medium to eliminate air pockets and rotated at a constant speed to simulate microgravity conditions. Further details regarding the principle and setup of the HARV system are described elsewhere (Kumar et al., 2015).

2.3. RNA extraction and integrity check

In this study, The RNeasy Plant Mini Kit was used to extract total RNA (Qiagen, Germany) as per the manufacturer’s instruction. RNA concentration was measured using the Epoch Microplate Spectrophotometer (BioTek, VT, USA). Next, RNA integrity was measured with the Agilent 2100 Bioanalyzer (Agilent Technologies, USA). High-quality RNA with intact 18S and 28S rRNA peaks was used for library preparation. Here, we have shown only for one as for reference.

2.4. Library preparation

Strand-specific RNA-sequencing libraries were prepared using the SureSelect Strand-Specific RNA Library Prep Kit for Illumina (Agilent, Cat. #5500-0116). mRNA was fragmented at 94°C for 4 minutes in the presence of divalent cations (Yesupatham, 2015; Sathishkumar et al., 2016), and first-strand cDNA synthesis was performed with the addition of Actinomycin D to maintain strand specificity. The cDNA was purified using HighPrep PCR beads (MAGBIO, Cat. #AC-60050), and second-strand synthesis was carried out using a dedicated mix. After end-repair and A-tailing, Illumina adapters were ligated, and SPRI cleanup was performed. Libraries were amplified using 12 PCR cycles and indexed for multiplex sequencing. Quality and concentration of libraries were verified using the Qubit DNA Assay Kit (Invitrogen, Cat. #Q-33120) and Agilent High Sensitivity Bioanalyzer Kit (Cat. #5067-4626).

2.5. Sequencing

Final libraries were assessed for insert size and quality using the Agilent DNA 1000 Kit on a 2100 Bioanalyzer. The expected insert sizes ranged from 80-480 bp, with total library sizes between 200–600 bp, including adapter sequences (~120 bp). Paired-end sequencing (75 bp × 2) was performed on an Illumina NextSeq platform.

2.6. Read processing and transcriptome assembly

Raw sequencing reads were quality checked using FASTQC (Babraham Bioinformatics). Adapter sequences and low-quality bases were trimmed using in-house scripts. High-quality reads were assembled de novo using Trinity (Grabherr et al., 2011) with default parameters and a k-mer size of 25. Assembled transcripts were annotated using BLAST+ (v2.2.29) against the Aspergillus protein database from UniProt, with a minimum identity threshold of 30% for downstream analyses. The differ ential expressed genes were identified using a p< 0.05, and a log2fold change equal to or higher than 1.

2.7. Differential gene expression and pathway analysis

Functional annotation and pathway analysis were conducted using KEGG Automatic Annotation Server (KAAS) (Moriya et al., 2007). Transcripts were clustered using CD-HIT (Li et al., 2001) to remove redundancy. Read alignment to the reference transcriptome was done using Bowtie2 (Langmead et al., 2012). Differential gene expression (DGE) analysis was performed using DESeq (Anders et al., 2010) across the following pairwise comparisons: 12 h normal gravity vs 12 h microgravity and 48 h normal gravity vs 48 h microgravity (Yesupatham, 2015; Sathishkumar et al., 2016). The schematic presentation of the sequencing analysis was given in Fig. 1 (Yesupatham, 2015; Sathishkumar et al., 2016).

Fig. 1.

Overview of experiment for reference based RNA-sequencing analysis of A. niger (Yesupatham, 2015; Sathishkumar et al., 2016).

2.8. Quantitative reverse‑transcription‑PCR (qRT‑PCR)

We carried out qRT-PCR on five arbitrarily selected upregulated genes in order to confirm the results from RNA-sequencing (Yesupatham, 2015; Sathishkumar et al., 2016). Using the Primer3 tool (Version 0.4.0), primer design for qRT-PCR was completed. Using the housekeeping gene GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), the mRNA levels of the DEGs were adjusted (Yesupatham, 2015; Sathishkumar et al., 2016; Sheet et al., 2024). Using the 2ΔΔct technique, relative gene expression values were calculated. In addition, the expression levels of regulated genes were compared between the RNA-sequencing and qRT-PCR data. Table 1 contains the primer sequences for the relevant genes and the reference gene (Yesupatham, 2015; Sathishkumar et al., 2016; Sheet et al., 2024).

List of all primers were used in the current investigation


3. Results and Discussion

The present study reveals significant gene expression changes in A. niger under simulated microgravity compared to normal gravity conditions, highlighting gravity’s role in modulating fungal physiology. Exposure to microgravity altered the expression of genes encoding ABC and MFS transporters, suggesting adaptations in nutrient uptake and cell wall integrity (Yesupatham et al., 2015). Notably, a sustained upregulation of citric acid synthase and oxaloacetate hydrolase genes underscores microgravity’s influence on organic acid biosynthesis, a hallmark of A. niger’s industrial utility. Similar to our previous study, we found here that exposure to microgravity conditions induced several molecular-level biological changes in the A. niger.

The assembly statistics for A. niger sequencing in this study demonstrate a robust and high-quality dataset (Table 1) (Yesupatham, 2015; Sathishkumar, et al., 2016). A total of 25,936 contigs were generated, with lengths ranging from 142 bp to a maximum of 12,256 bp. The average contig length was 1,105.2 bp (±1,041.3), and the median contig length was 1,534 bp, indicating a substantial proportion of longer contigs. The total assembled contig length reached approximately 37.8 Mb, which is consistent with the reported genome size of A. niger strains (33.9–38.5 Mb) (Pel et al., 2007). The N50 value of 1,787 bp reflects moderate assembly continuity, with half of the total assembly contained in contigs of this length or longer. Importantly, there were no non-ATGC characters, confirming the high sequence quality. The dataset includes 10,255 contigs of at least 1 Kbp and 61 contigs of at least 10 Kbp, supporting the completeness and reliability of the assembly.

Contig statistics from Aspergillus niger transcriptome assembly (Yesupatham, 2015)

3.1. Gene expression and gene ontology

At 12 h, a total of 137 genes were upregulated and 35 genes were downregulated in A. niger grown under microgravity conditions compared to normal gravity (Appendix 1 and Appendix 2, respectively). Notably, at 48 h, the trend shifted, with only 61 genes upregulated and 161 genes downregulated (data not shown). More number of genes are upregulated at the 12 h samples compared to 48 h samples, suggesting that the organism is slowly adapting to the microgravity conditions (Yesupatham, 2015; Sathishkumar et al., 2016). This temporal expression pattern indicates a strong early response to microgravity, which appears to subside over time. A heat map with hierarchical clustering (Fig. 2) illustrates the differential gene expression profiles for both time points. The heatmaps illustrate the gene expression profiles of A. niger under normal gravity and microgravity at 12 h and 48 h. At 12 h, there is minimal difference between the normal gravity and microgravity conditions, with most genes showing similar expression levels (predominantly orange and red), indicating only modest early transcriptional changes. However, by 48 h, distinct differences emerge: several genes in the microgravity group display marked upregulation (red) or downregulation (green) compared to normal gravity, reflecting significant transcriptional reprogramming in response to prolonged microgravity exposure. This pattern suggests that A. niger adapts to microgravity over time, with more pronounced gene expression changes occurring after extended exposure. More number of genes are upregulated at the 12 h samples compared to 48 h samples, suggesting that the organism is slowly adapting to the microgravity conditions.

Fig. 2.

Heat maps depicting the global gene expression profiles of A. niger under microgravity and normal gravity conditions were generated using the plot package. Each row corresponds to a single gene. In the visualization, green indicates high expression levels, while red denotes low expression levels. NG- normal gravity and MG- microgravity (Yesupatham, 2015).

To further investigate the biological significance, the transcripts were annotated using the KEGG Automatic Annotation Server (KAAS), which assigns functional categories based on BLAST alignment against the curated KEGG GENES database. The higher number of upregulated genes at 12 h suggests an acute response phase, while the reduced transcriptional activity at 48 h implies that A. niger begins to adapt to the microgravity environment over time. Our RNA-sequencing analysis of A. niger exposed to microgravity revealed significant changes in gene expression, particularly in categories related to membrane transport, metabolism, stress response, and gene regulation. At 12 h, the gene ontology (GO) analysis of A. niger grown under microgravity versus normal gravity conditions reveals significant alterations across key functional categories (Fig. 3). In the Molecular Function category, enriched terms such as ATP binding (7.53%), DNA binding (5.81%), and zinc ion binding (5.32%) indicate heightened energy metabolism and regulatory activity, likely in response to the altered environment. Activities like RNA polymerase II transcription factor binding and nuclease functions further suggest increased transcriptional control and nucleic acid turnover under stress. Within the biological process category, regulation of transcription (3.81%) and protein folding (3.57%) reflect adaptive responses to microgravity, while processes such as carbohydrate metabolism, oxidation-reduction, and transmembrane transport point to shifts in core metabolic and homeostatic mechanisms. Whereas the integral membrane component (11.16%), cytosol (8.31%), and mitochondrion (1.95%), highlighting structural and organellar adaptations, especially in membranes and energy-related functions were the important GO terms found to be associated under cellular component group. Collectively, these findings suggest that microgravity triggers a coordinated response involving transcriptional reprogramming, metabolic adjustments, and cellular structural remodeling. At 48 h, major changes in the cellular component comes from the nucleus (12.82%) and integral component of membrane (11.28%) (Fig. 4) (Yesupatham, 2015; Sathishkumar, 2016). Regarding the changes in biological process transmembrane transport (4.24%) and carbohydrate metabolism (1.86%) are shown to be noteworthy (Yesupatham, 2015; Sathishkumar et al., 2016). Many studies have proposed that changes in the carbohydrate metabolism is directly linked with the pathogenicity of fungus. Although some of the fungi are shown to be more pathogenic under microgravity, no transcripts were annotated to the pathogenicity related gene set database (Yesupatham, 2015). Molecular functions like Zn++ ion binding (9.39%), ATP binding (7.61%) and oxidative reductase (4.86%) are shown to be increased under 48 h of exposure to microgravity, which could be the reason for A. niger to become more tolerant to pH, acid and oxidative stress (Yesupatham, 2015).

Fig. 3.

Gene Ontology (GO) classification of differentially expressed genes in A. niger after 12 h under normal gravity and microgravity conditions (Yesupatham, 2015).

Fig. 4.

Gene Ontology (GO) classification of differentially expressed genes in A. niger after 48 h under normal gravity and microgravity conditions (Yesupatham, 2015).

The GO enrichment showed that a substantial proportion of differentially expressed genes were involved in ion binding, ATP binding, and oxidoreductase activity, indicating shifts in energy metabolism and redox balance. Many of these genes were associated with membrane components and transmembrane transport, suggesting adaptations in nutrient uptake and environmental sensing under microgravity. There was also notable enrichment in genes related to carbohydrate metabolism, biosynthetic processes, and stress response, reflecting metabolic reprogramming and activation of protective pathways. These findings are reliable with earlier reports, for example published by Zhang et al. and Mauclaire et al., which reported upregulation of transporter genes and stress-related pathways in fungi under microgravity (Mauclaire et al., 2010; Zhang et al., 2022). Similarly, Schuster et al. and Mastroleo et al. observed that microgravity can enhance metabolic flexibility and secondary metabolite production in A. niger and other fungi (Schuster et al., 2002; Mastroleo et al., 2010). The observed transcriptional changes, including increased expression of genes involved in DNA and RNA binding and transcription factor activity, further support the idea of broad transcriptional reprogramming as an adaptive response to altered gravity, as noted in transcriptomic studies by Wang et al. and Crabbé et al. (Wang et al., 2009; Crabbé et al., 2013). Collectively, these results suggest that A. niger adapts to microgravity by modulating key biological pathways, which may enhance its resilience and metabolic output, aligning with concerns about fungal risks and opportunities in space environments (Taylor et al., 1993; Novikova, 2004). Our RNA-sequencing GO analysis reveals that A. niger responds to simulated microgravity by adjusting transcriptional activity, stress response, metabolic processes, and membrane/cytosolic dynamics. These changes are consistent with previous microgravity studies across microbial systems and reinforce concerns about fungal adaptability and potential pathogenicity in space environments.

Additionally, we analyzed the expression of genes associated with environmental stimulus response and stress tolerance in both the 12 h and 48 h groups. Notably, significant changes were observed only in the 12 h microgravity group, while the 48 h group showed minimal differential expression in these categories. Therefore, only the results from the 12 h group are presented and discussed here (Fig. 5 and Fig. 6). Genes associated with environmental stimulus response were analyzed, revealing that 13 genes were upregulated under microgravity, compared to 6 genes under normal gravity (Yesupatham, 2015). Interestingly, 28 genes were downregulated in the microgravity condition, while 22 were downregulated under normal gravity. These findings suggested that A. niger is capable of sensing microgravity as a distinctive environmental cue. The Venn diagram indicated no overlap between the stimulus-responsive genes in the two conditions, implying that entirely different gene sets are involved in responding to microgravity. Moreover, our qRT-PCR resuls showed that expression levels of up-regulated genes (EglA, Sph3, CatA, CatR, AoxB, AbcA, AbcB, XlnR, and XyrA) in 12 h group under normal gravity and microgravity conditions, which validated the findings from the RNA-sequencing analysis (Fig. 7) (Yesupatham, 2015). The qRT-PCR data shows significant upregulation of all ten genes in Aspergillus niger under simulated microgravity. Key transcriptional regulators (AmyR, ~4-fold; XlnR, ~2.2-fold) and their target enzymes (EglA, and XlnA) are upregulated, enhancing carbohydrate metabolism. CatA (catalase A) and CatR (catalase regulator) both show upregulation (~2.2-fold and ~1.6-fold respectively). Catalases are essential antioxidant enzymes that protect cells from oxidative stress by decomposing hydrogen peroxide (Vaquer et al., 2014). AoxB (alternative oxidase B) demonstrates a notable ~3.4-fold increase, suggesting enhanced alternative respiratory pathways that help manage cellular stress and maintain energy homeostasis (Zhao et al., 2010). The ABC transporters AbcA and AbcB1 show significant upregulation (~3-fold and ~1.8-fold respectively). These ATP-binding cassette transporters are involved in the efflux of various compounds, including toxins and metabolites, suggesting enhanced cellular detoxification mechanisms under microgravity (Vaquer et al., 2014). Upregulated ABC transporters (AbcA, and AbcB1) indicate enhanced detoxification. Overall, A. niger activates a coordinated response to microgravity stress, enhancing metabolic flexibility, antioxidant defense, and detoxification capacity. Although, further identification and functional characterization of these unique genes are warranted. Transcripts which have significance at p< 0.001 were used for the generating the Venn diagram (Yesupatham, 2015). Overall, the results show the changes in A. niger under microgravity at molecular level with extra clarity and various dimensions, unlike the conventional limited data from microarray studies (Yesupatham, 2015). These results are reliable with prior findings showed that microgravity acts as a significant environmental stressor, triggering broad transcriptional reprogramming in fungi. For instance, Zhang et al. and Tesei et al. reported that fungi exposed to microgravity or simulated microgravity exhibit increased expression of genes involved in environmental adaptation and stress response, including transporters, oxidoreductases, and stress-protective proteins (Tesei et al., 2021; Zhang et al., 2022). Collectively, these results highlight that microgravity induces a more pronounced and complex adaptive response in A. niger compared to normal gravity, supporting the view that space environments can significantly influence fungal physiology and stress resilience.

Fig. 5.

Venn diagram indicating the number of differentially expressed genes under microgravity and normal gravity corresponding to environmental stress in A. niger. Transcripts which have significance at p<0.001 were used for the generating the graph (Yesupatham, 2015).

Fig. 6.

Venn diagram indicating the number of differentially expressed genes under microgravity and normal gravity corresponding to stress tolerance in A. niger. Transcripts which have significance at p<0.001 were used for the generating the graph (Yesupatham, 2015).

Fig. 7.

RT-qPCR results of A. niger after cultivating at NG and MG environments for 12 h. The values represent the mean ± standard deviation (n = 3). NG- normal gravity; MG-Microgravity.


4. Conclusions

Collectively this study reports an inclusive transcriptomic analysis of A. niger in response to microgravity using reference based RNA-sequencing method. The enzymatic system of A. niger is boosted by microgravity which can be exploited industrially for the increased production of enzymes (Yesupatham, 2015). This is the first report on the gene expression changes in A. niger under microgravity. Information from previous reports was significantly scarce to predict the biological pathways affected under microgravity. The results obtained in this study not necessarily reflects the changes found in real space conditions as the effects of radiation and vibrations are avoided in our laboratory set up HARV (Yesupatham, 2015). But, the basic knowledge obtained through this reference based RNA-Sequencing study should lay a foundation for future research in the field of space microbiology for the betterment of the astronaut crew health considering the long term space missions (Yesupatham, 2015).

Acknowledgments

This article is partly based on the author's doctoral dissertation submitted to Jeonbuk National University in 2015. The complete manuscript has been rewritten and edited, and additional qRT-PCR experimental validation was conducted by the author, which was not part of the original dissertation. During the preparation of his response, authors used ChatGPT-4o to improve readability and language. After using this tool, author reviewed and edited the content as needed and takes full responsibility for the final publication.

REFERENCES

  • Abarca, M. L., Bragulat, M. R., Castella, G., Cabanes, F. J., 1994, Ochratoxin A production by strains of Aspergillus niger var. niger, Appl. Environ. Microbiol., 60(7), 2650-2652. [https://doi.org/10.1128/aem.60.7.2650-2652.1994]
  • Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J., 1990, Basic local alignment search tool, J. Mol. Biol., 215(3), 403-410. [https://doi.org/10.1016/S0022-2836(05)80360-2]
  • Anderegg, R. J., Biemann, K., Buechi, G., Cushman, M., 1976, Malformin C, A New metabolite of Aspergillus niger, J. Am. Chem. Soc., 98(11), 3365-3370. [https://doi.org/10.1021/ja00427a051]
  • Anders, S., Huber, W., 2010, Differential expression analysis for sequence count data, Genome Biol., 11(10), R106. [https://doi.org/10.1186/gb-2010-11-10-r106]
  • Bhadauria, V., Popescu, L., Zhao, W. S., Peng, Y. L., 2007, Fungal transcriptomics, Microbiol. Res., 162(4), 285-298. [https://doi.org/10.1016/j.micres.2007.06.006]
  • Binder, R. E., Faling, L. J., Pugatch, R, D., Mahasaen, C., Snider, G. L., 1982, Chronic necrotizing pulmonary aspergillosis: A Discrete clinical entity, Medicine, 61(2), 109. [https://doi.org/10.1097/00005792-198203000-00005]
  • Breakspear, A., Momany, M., 2007, The first fifty microarray studies in filamentous fungi, Microbiology, 153(Pt 1), 7-15. [https://doi.org/10.1099/mic.0.2006/002592-0]
  • Brown, R. B., Klaus, D., Todd, P., 2002, Effects of space flight, clinorotation, and centrifugation on the substrate utilization efficiency of Escherichia coli, Microgravity Sci. Technol., 13(4), 24-29. [https://doi.org/10.1007/BF02881678]
  • Cahill, K. M., El Mofty, A. M., Kawaguchi, T. P., 1967, Primary cutaneous aspergillosis, Arch. Dermatol., 96(5), 545-547. [https://doi.org/10.1001/archderm.1967.01610050067010]
  • Frisvad, J. C., Smedsgaard, J., Samson, R. A., Larsen, T. O., Thrane, U., 2007, Fumonisin B2 production by Aspergillus niger, J. Agric. Food Chem., 55(23), 9727-9732. [https://doi.org/10.1021/jf0718906]
  • Ghosal, S., Biswas, K., Chakrabarti, D. K., 1979, Toxic naphtho-. gamma.-pyrones from Aspergillus niger, J. Agric. Food Chem., 27(6), 1347-1351. [https://doi.org/10.1021/jf60226a018]
  • Goldermann, M., Hanke, W., 2001, Ion channel are sensitive to gravity changes, Microgravity Sci. Technol., 13(1), 35-38. [https://doi.org/10.1007/BF02873330]
  • Grabherr, M. G., Haas, B. J., Yassour, M., Levin, J. Z., Thompson, D. A., Amit, I., Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q., Chen, Z., Mauceli, E., Hacohen, N., Gnirke, A., Rhind, N., di Palma, F., Birren, B. W., Nusbaum, C., Lindblad-Toh, K., Friedman, N., Regev, A., 2011, Full-length transcriptome assembly from RNA-Seq data without a reference genome, Nat. Biotechnol., 29(7), 644-652. [https://doi.org/10.1038/nbt.1883]
  • Horneck, G., Klaus, D. M., Mancinelli, R. L., 2010, Space microbiology, Microbiol. Mol. Biol. Rev., 74(1), 121-156. [https://doi.org/10.1128/MMBR.00016-09]
  • Ibekwe, A. O., Okafor, J. I., 1983, Pathogenic organisms in chronic suppurative otitis media in Enugu, Nigeria, Trop. Geogr. Med., 35(4), 389-391.
  • Isogai, A., Horii, T., Suzuki, A., Murakoshi, S., Ikeda, K., Sato, S., Tamura, S., 1975, Isolation and identification of nigragillin as a insecticidal metabolite produced by a Aspergillus niger, Agric. Biol. Chem., 39(3), 739-740. [https://doi.org/10.1271/bbb1961.39.739]
  • Jennings, M. E., Quick, L. N., Soni, A., Davis, R. R., Crosby, K., Ott, C. M., Nickerson, C. A., Wilson, J. W., 2011, Characterization of the Salmonella enterica serovar Typhimurium ydcI gene, which encodes a conserved DNA binding protein required for full acid stress resistance, J. Bacteriol., 193(9), 2208-2217. [https://doi.org/10.1128/JB.01335-10]
  • Kraft, T. F., van Loon, J. J., Kiss, J. Z., 2000, Plastid position in Arabidopsis columella cells is similar in microgravity and on a random-positioning machine, Planta, 211(3), 415-422. [https://doi.org/10.1007/s004250000302]
  • Kumar, Y. S., Unnithan, A. R., Sen, D., Kim, C. S., Lee, Y. S., 2015, Microgravity biosynthesized penicillin loaded electrospun polyurethane-dextran nanofibrous mats for biomedical applications, Colloids Surf. A: Physicochem. Eng. Asp., 477, 77-83. [https://doi.org/10.1016/j.colsurfa.2015.01.065]
  • Langmead, B., Salzberg, S. L., 2012, Fast gapped-read alignment with Bowtie 2, Nat. Methods, 9(4), 357-359. [https://doi.org/10.1038/nmeth.1923]
  • Li, W., Jaroszewski, L., Godzik, A., 2001, Clustering of highly homologous sequences to reduce the size of large protein databases, Bioinformatics, 17(3), 282-283. [https://doi.org/10.1093/bioinformatics/17.3.282]
  • Makimura, K., Hanazawa, R., Takatori, K., Tamura, Y., Fujisaki, R., Nishiyama, Y., Abe, S., Uchida, K., Kawamura, Y., Ezaki, T., Yamaguchi, H., 2001, Fungal flora on board the mir‐space station, Identification by morphological features and ribosomal DNA sequences, Microbiol. Immunol., 45(5), 357-363. [https://doi.org/10.1111/j.1348-0421.2001.tb02631.x]
  • Mastroleo, F., Van Houdt, R., Atkinson, S., Mergeay, M., Hendrickx, L., Wattiez, R., Leys, N., 2013, Modelled microgravity cultivation modulates N-acylhomoserine lactone production in Rhodospirillum rubrum S1H independently of cell density, Microbiology, 159(Pt 12), 2456-2466. [https://doi.org/10.1099/mic.0.066415-0]
  • Mauclaire, L., Egli, M., 2010, Effect of simulated microgravity on growth and production of exopolymeric substances of Micrococcus luteus space and earth isolates, FEMS Immunol. Med. Microbiol., 59(3), 350-356. [https://doi.org/10.1111/j.1574-695X.2010.00683.x]
  • Metzger, J., Garagusi, V., Kerwin, D., 1984, Pulmonary oxalosis caused by Aspergillus niger, Am. Rev. Respir. Dis., 129(3), 501-502.
  • Morabito, C., Steimberg, N., Mazzoleni, G., Guarnieri, S., Fanò-Illic, G., Mariggiò, M. A., 2015, RCCS bioreactor-based modelled microgravity induces significant changes on in vitro 3D neuroglial cell cultures, BioMed Res. International, 754283. [https://doi.org/10.1155/2015/754283]
  • Morey-Holton, E. R., Globus, R. K., 2002, Hindlimb unloading rodent model: Technical aspects, J. Appl. Physiol., 92(4), 1367-1377. [https://doi.org/10.1152/japplphysiol.00969.2001]
  • Moriya, Y., Itoh, M., Okuda, S., Yoshizawa, A. C., Kanehisa, M., 2007, KAAS: An Automatic genome annotation and pathway reconstruction server, Nucleic Acids Res., 35(2), W182-W185. [https://doi.org/10.1093/nar/gkm321]
  • Novikova, N. D., 2004, Review of the knowledge of microbial contamination of the Russian manned spacecraft, Microb. Ecol., 47(2), 127-132. [https://doi.org/10.1007/s00248-003-1055-2]
  • Onofri, S., Barreca, D., Selbmann, L., Isola, D., Rabbow, E., Horneck, G., de Vera, J. P., Hatton, J., Zucconi, L., 2008, Resistance of Antarctic black fungi and cryptoendolithic communities to simulated space and Martian conditions, Stud. Mycol., 61, 99-109. [https://doi.org/10.3114/sim.2008.61.10]
  • Pel, H. J., de Winde, J. H., Archer, D. B., Dyer, P. S., Hofmann, G., Schaap, P. J., 2007, Genome sequencing and analysis of the versatile cell factory Aspergillus niger CBS 513.88, Nat. Biotechnol, 25(2), 221-231. [https://doi.org/10.1038/nbt1282]
  • Richter, P. R., Schuster, M., Wagner, H., Lebert, M., Häder, D. P., 2002, Physiological parameters of gravitaxis in the flagellate Euglena gracilis obtained during a parabolic flight campaign, J. Plant Physiol., 159(2), 181-190. [https://doi.org/10.1078/0176-1617-00605]
  • Sathishkumar, Y., Velmurugan, N., Lee, H. M., Rajagopal, K., Im, C. K., Lee, Y. S., 2014, Effect of low shear modeled microgravity on phenotypic and central chitin metabolism in the filamentous fungi Aspergillus niger and Penicillium chrysogenum, Antonie Van Leeuwenhoek, 160(2), 197-209. [https://doi.org/10.1007/s10482-014-0181-9]
  • Sathishkumar, Y., Krishnaraj, C., Rajagopal, K., Sen, D., Lee, Y. S., 2016, High throughput de novo RNA sequencing elucidates novel responses in Penicillium chrysogenum under microgravity, Bioprocess Biosyst. Eng., 39(2), 223-231. [https://doi.org/10.1007/s00449-015-1506-4]
  • Scalzi, G., Selbmann, L., Zucconi, L., Rabbow, E., Horneck, G., Albertano, P., Onofri, S., 2012, LIFE Experiment: Isolation of cryptoendolithic organisms from Antarctic colonized sandstone exposed to space and simulated Mars conditions on the international space station, Orig. Life Evol. Biosph., 42(2-3), 253-262. [https://doi.org/10.1007/s11084-012-9282-5]
  • Schuster, E., Dunn-Coleman, N., Frisvad, J. C., Van Dijck, P. W., 2002, On the safety of Aspergillus niger–a review, Appl. Microbiol. Biotechnol., 59(4-5), 426-435. [https://doi.org/10.1007/s00253-002-1032-6]
  • Sheet, S., Jang, S. S., Kim, J. H., Park, W., Kim, D. A., 2024, A Transcriptomic analysis of skeletal muscle tissues reveals promising candidate genes and pathways accountable for different daily weight gain in Hanwoo cattle, Sci. Rep., 14(1), 315. [https://doi.org/10.1038/s41598-023-51037-9]
  • Souza, G. R., Molina, J. R., Raphael, R. M., Ozawa, M. G., Stark, D. J., Levin, C. S., Bronk, L. F., Ananta, J. S., Mandelin, J., Georgescu, M. M., Bankson, J. A., Gelovani, J. G., Killian, T. C., Arap, W., Pasqualini, R., 2010, Three-dimensional tissue culture based on magnetic cell levitation, Nat. Nanotechnol., 5(4), 291-296. [https://doi.org/10.1038/nnano.2010.23]
  • Stöffler, D., Horneck, G., Ott, S., Hornemann, U., Cockell, C. S., Moeller, R., Meyer, C., de Vera, J., Fritz, J., Artemieva, N. A., 2007, Experimental evidence for the potential impact ejection of viable microorganisms from Mars and Mars-like planets, Icarus, 186(2), 585-588. [https://doi.org/10.1016/j.icarus.2006.11.007]
  • Taylor, G. R., 1993, Overview of spaceflight immunology studies, J. Leukoc. Biol., 54(3), 179-188. [https://doi.org/10.1002/jlb.54.3.179]
  • Taylor, G. R., Konstantinova, I., Sonnenfeld, G., Jennings, R., 1996, Changes in the immune system during and after spaceflight, Adv. Space Biol. Med., 6, 1-32. [https://doi.org/10.1016/S1569-2574(08)60076-3]
  • Tesei, D., Chiang, A. J., Kalkum, M., Stajich, J. E., Mohan, G. B. M., Sterflinger, K., Venkateswaran, K., 2021, Effects of simulated microgravity on the proteome and secretome of the polyextremotolerant black fungus Knufia chersonesos, Front. Genet., 12, 638708. [https://doi.org/10.3389/fgene.2021.638708]
  • Tesei, D., Marzban, G., Zakharova, K., Isola, D., Selbmann, L., Sterflinger, K., 2012, Alteration of protein patterns in black rock inhabiting fungi as a response to different temperatures, Fungal Biol., 116(8), 932-940. [https://doi.org/10.1016/j.funbio.2012.06.004]
  • Vaquer, S., Cuyàs, E., Rabadán, A., González, A., Fenollosa, F., de la Torre, R., 2014, Active transmembrane drug transport in microgravity: A Validation study using an ABC transporter model, F1000Res., 3, 201. [https://doi.org/10.12688/f1000research.4909.1]
  • Vunjak‐novakovic, G., Searby, N., de Luis, J., Freed, L. E., 2002, Microgravity studies of cells and tissues, Ann. N. Y. Acad. Sci., 974, 504-517. [https://doi.org/10.1111/j.1749-6632.2002.tb05927.x]
  • Wang, K., Li, M., Hakonarson, H., 2010, Analysing biological pathways in genome-wide association studies, Nat. Rev. Genet., 11(12), 843-854. [https://doi.org/10.1038/nrg2884]
  • Wang, Z., Gerstein, M., Snyder, M., 2009, RNA-Seq: A Revolutionary tool for transcriptomics, Nat. Rev. Genet., 10(1), 57-63. [https://doi.org/10.1038/nrg2484]
  • White, R. J., Averner, M., 2001, Humans in space, Nature, 409(6823), 1115-1118. [https://doi.org/10.1038/35059243]
  • Yesupatham, S. K., 2015, The phenotypic and transcriptomic analysis of Penicillium chrysogenum and Aspergillus niger in response to low shear modelled microgravity, Ph. D. thesis, Jeonbuk National University, Korea, 115.
  • Yesupatham, S. K., Unnithan, A. R., Sen, D., Kim, C. S., Lee, Y. S., 2015, Microgravity biosynthesized penicillin loaded electrospun polyurethane-dextran nanofibrous mats for biomedical applications, Colloids Surf. A: Physicochem. Eng. Asp., 477, 77-83. [https://doi.org/10.1016/j.colsurfa.2015.01.065]
  • Zhang, X., Fang, X., Liu, C., 2015, Genomic and proteomic analysis of Escherichia coli after spaceflight reveals changes involving metabolic pathways, Arch. Med. Res., 46(3), 181-185. [https://doi.org/10.1016/j.arcmed.2015.03.007]
  • Zhang, Y., Zhang, X., Zhang, J., Ali, S., Wu, J., 2022, Spaceflight changes the production and bioactivity of secondary metabolites in Beauveria bassiana, Toxins, 14(8), 555. [https://doi.org/10.3390/toxins14080555]
  • Zhao, C., Sun, Y., Yi, Z. C., Rong, L., Zhuang, F. Y., Fan, Y. B., 2010, Simulated microgravity inhibits cell wall regeneration of Penicillium decumbens protoplasts, Adv. Space Res., 46(6), 701-706. [https://doi.org/10.1016/j.asr.2010.04.026]

Appendix

Genes Up-regulated under microgravity at 12 h (Yesupatham, 2015)

Genes downregulated under microgravity at 12 hours (Yesupatham, 2015)

・ Post-doc. Yesupatham Sathiskumar

Department of Wood Science and Technology, College of Agriculture and Life Sciences, Chonbuk National Universitysunirmalsheet@gmail.com

・ Professor. Yang Soo Lee

Department of Wood Science and Technology, College of Agriculture and Life Sciences, Chonbuk National Universityysoolee@jbnu.ac.kr

・ Post-doc. Sunirmal Sheet

Department of Wood Science and Technology, College of Agriculture and Life Sciences, Chonbuk National Universitysunirmal123@korea.kr

Fig. 1.

Fig. 1.
Overview of experiment for reference based RNA-sequencing analysis of A. niger (Yesupatham, 2015; Sathishkumar et al., 2016).

Fig. 2.

Fig. 2.
Heat maps depicting the global gene expression profiles of A. niger under microgravity and normal gravity conditions were generated using the plot package. Each row corresponds to a single gene. In the visualization, green indicates high expression levels, while red denotes low expression levels. NG- normal gravity and MG- microgravity (Yesupatham, 2015).

Fig. 3.

Fig. 3.
Gene Ontology (GO) classification of differentially expressed genes in A. niger after 12 h under normal gravity and microgravity conditions (Yesupatham, 2015).

Fig. 4.

Fig. 4.
Gene Ontology (GO) classification of differentially expressed genes in A. niger after 48 h under normal gravity and microgravity conditions (Yesupatham, 2015).

Fig. 5.

Fig. 5.
Venn diagram indicating the number of differentially expressed genes under microgravity and normal gravity corresponding to environmental stress in A. niger. Transcripts which have significance at p<0.001 were used for the generating the graph (Yesupatham, 2015).

Fig. 6.

Fig. 6.
Venn diagram indicating the number of differentially expressed genes under microgravity and normal gravity corresponding to stress tolerance in A. niger. Transcripts which have significance at p<0.001 were used for the generating the graph (Yesupatham, 2015).

Fig. 7.

Fig. 7.
RT-qPCR results of A. niger after cultivating at NG and MG environments for 12 h. The values represent the mean ± standard deviation (n = 3). NG- normal gravity; MG-Microgravity.

Table 1.

List of all primers were used in the current investigation

List Forward Primer (5′-3′) Reverse Primer (5′-3′)
AmyR GTCCCGTTCCCATCGATTTG TTGATCATGCTGTCCCCACT
EglA CCCTGTGACACTTGCTATGC ACTGCTGGAGAGTTTGTCGA
Sph3 GGCCTTCTCCCTCTTCGTAA TGATCATGTCCTGCAGCTCA
CatA TCGCTACGTCTGATAACCCC TTGCGTTAACACAAGCCTCC
CatR CCTCTCGGAATGATGGAGCT GAGGTAGGAGAAGAGACGGC
AoxB CGATGGTGCACTGATTTCGT CTTCAGATGTCGGAGCATGC
AbcA CGGCCTGCAAAGACATACTC GAAAGCCGCGATCATGAAGT
AbcB1 TCACGTCTTGGTGGCCG CGGTCCCCTTCAAGATCCAT
XlnR CTTCTTCGTCCCACCTGTCT CGGCGATGTCAAGAAAGGAG
XyrA TGGCCTCTCCCACAGTAAAG CCATAGTCCTGGTTTGCGTG
Gapdh CCACTCCTACACTGCTACCC GCCTCCTTGATCTGGTCGTA

Table 2.

Contig statistics from Aspergillus niger transcriptome assembly (Yesupatham, 2015)

Contigs generated 25,936
Maximum contig length 12,256
Minimum contig length 142
Average contig length 1,105.2 ± 1,041.3
Median contig length 1,534.00
Total contigs length 37,837,149
Total number of non-ATGC characters 0
Percentage of non-ATGC characters 0
Contigs ≥100 bp 32,124
Contigs ≥200 bp 32,124
Contigs ≥500 bp 15,337
Contigs ≥1 Kbp 10,255
Contigs ≥10 Kbp 61
Contigs ≥1 Mbp 0
N50 value 1787

Appendix 1.

Genes Up-regulated under microgravity at 12 h (Yesupatham, 2015)

Transcript_ID (Query) log2 (fold change) Gene Ontology (GO)
TCONS_00000023 3.22789 Similarity to hypothetical protein encoded by An15g00800 - Aspergillus niger
TCONS_00000043 3.21936 Uncharacterized protein
TCONS_00000044 1.49793 oxidoreductase activity [GO:0016491]
TCONS_00000377 2.53904 Similarity to essential protein #47 WO2003076464-A2 - Aspergillus fumigatus
TCONS_00000946 1.72349 Remark: alternate names for Drosophila eld: eyelid or osa
TCONS_00001001 2.29757 2-methylcitrate dehydratase activity [GO:0047547]; propionate catabolic process [GO:0019543]
TCONS_00001151 3.40244 Function: Bcl-3
TCONS_00001486 1.88274 damaged DNA binding [GO:0003684]; deoxycytidyl transferase activity [GO:0017125];
DNA-dependent DNA replication [GO:0006261];
DNA-directed DNA polymerase activity [GO:0003887]; error-free translesion synthesis [GO:0070987]; error-prone translesion synthesis [GO:0042276]; mitochondrion [GO:0005739]; mitotic spindle [GO:0072686]; nucleolus [GO:0005730]; replication fork [GO:0005657]; site of double-strand break [GO:0035861]
TCONS_00001606 3.0984 monooxygenase activity [GO:0004497]; oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen [GO:0016705]
TCONS_00001609 1.76604 1-alkyl-2-acetylglycerophosphocholine esterase activity [GO:0003847]; lipid catabolic process [GO:0016042]
TCONS_00002418 1.76786 integral component of membrane [GO:0016021]; transmembrane transport [GO:0055085]
TCONS_00002521 2.42679 histone deacetylase activity [GO:0004407]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; regulation of transcription involved in G1/S transition of mitotic cell cycle [GO:0000083]
TCONS_00002572 2.06429 ubiquitin-dependent protein catabolic process [GO:0006511]
TCONS_00003027 3.67403 Uncharacterized protein
TCONS_00003245 2.31947 methyltransferase activity [GO:0008168]; oxidoreductase activity [GO:0016491]; secondary metabolic process [GO:0019748]; zinc ion binding [GO:0008270]
TCONS_00003264 2.62193 hydrolase activity [GO:0016787]
TCONS_00003266 3.33386 ATPase activity, coupled to transmembrane movement of substances [GO:0042626]; ATP binding [GO:0005524]; integral component of membrane [GO:0016021]
TCONS_00003326 3.03173 hydrolase activity [GO:0016787]
TCONS_00003673 2.63524 5-oxoprolinase (ATP-hydrolyzing) activity [GO:0017168]
TCONS_00003686 2.17822 catechol 1,2-dioxygenase activity [GO:0018576]; catechol-containing compound metabolic process [GO:0009712]; ferric iron binding [GO:0008199]
TCONS_00003781 1.7786 Uncharacterized protein
TCONS_00003976 1.79509 cytosol [GO:0005829]; phosphatase activity [GO:0016791]
TCONS_00003996 1.73252 Putative uncharacterized protein
TCONS_00004082 2.73397 Similarity to hypothetical protein SPAC869.06c - Schizosaccharomyces pombe
TCONS_00004270 2.19322 Uncharacterized protein
TCONS_00005579 2.04863 Putative uncharacterized protein
TCONS_00005729 2.12004 carbon-sulfur lyase activity [GO:0016846]
TCONS_00006416 2.09725 NAD binding [GO:0051287]; pentose-phosphate shunt [GO:0006098]; phosphogluconate dehydrogenase (decarboxylating) activity [GO:0004616]
TCONS_00007287 1.44469 Uncharacterized protein
TCONS_00007765 2.86032 Similarity to sequence 1 from patent EP0845532 - Pseudomonas sp
TCONS_00007830 2.0245 Putative uncharacterized protein An01g12020
TCONS_00007990 1.93256 ATP binding [GO:0005524]; protein metabolic process [GO:0019538]
TCONS_00008381 1.70629 integral component of membrane [GO:0016021]; substrate-specific transmembrane transporter activity [GO:0022891]
TCONS_00008747 1.46159 oxidoreductase activity [GO:0016491]; zinc ion binding [GO:0008270]
TCONS_00008778 4.2146 electron carrier activity [GO:0009055]; molybdenum ion binding [GO:0030151]; oxidoreductase activity [GO:0016491]
TCONS_00008792 3.30202 catalytic activity [GO:0003824]
TCONS_00008850 3.95799 Uncharacterized protein
TCONS_00009359 3.02986 integral component of membrane [GO:0016021]; plasma membrane [GO:0005886]; sulfite transmembrane transporter activity [GO:0000319]; sulfite transport [GO:0000316]
TCONS_00009662 3.19388 Uncharacterized protein
TCONS_00009713 1.89106 integral component of membrane [GO:0016021]; substrate-specific transmembrane transporter activity [GO:0022891]
TCONS_00010014 2.02992 integral component of membrane [GO:0016021]; substrate-specific transmembrane transporter activity [GO:0022891]
TCONS_00010521 4.05366 catalytic activity [GO:0003824]; secondary metabolic process [GO:0019748]
TCONS_00010566 1.83859 catalytic activity [GO:0003824]; coenzyme binding [GO:0050662]
TCONS_00010573 3.55943 Similarity to hypothetical protein encoded by Orf10 - Yersinia enterocolitica
TCONS_00011034 3.99357 catalytic activity [GO:0003824]; coenzyme binding [GO:0050662]
TCONS_00011088 2.60248 Putative uncharacterized protein An12g06130
TCONS_00011302 1.57107 Remark: the ORF contains many Prolins
TCONS_00011526 2.42768 hydrolase activity [GO:0016787]
TCONS_00011561 1.4293 Glutamine-serine-proline rich protein
TCONS_00011911 2.32154 adenyl-nucleotide exchange factor activity [GO:0000774]; cytoplasm-associated proteasomal ubiquitin-dependent protein catabolic process [GO:0071629]; cytoplasmic translation [GO:0002181]; cytosolic ribosome [GO:0022626]; nucleus [GO:0005634]; regulation of translation [GO:0006417]
TCONS_00012492 3.71219 Similarity to hypothetical protein BH0305 -Bacillus halodurans
TCONS_00012505 1.5412 Uncharacterized protein
TCONS_00012703 1.51801 Putative uncharacterized protein An15g07090
TCONS_00013219 3.01976 Uncharacterized protein
TCONS_00013430 1.83996 Uncharacterized protein
TCONS_00013872 2.93507 catalytic activity [GO:0003824]; trehalose biosynthetic process [GO:0005992]
TCONS_00013877 1.73083 FMN binding [GO:0010181]; oxidoreductase activity [GO:0016491]
TCONS_00014157 2.38122 Putative uncharacterized protein
TCONS_00014383 4.33315 NA
TCONS_00014621 2.23072 FMN binding [GO:0010181]; oxidoreductase activity [GO:0016491]
TCONS_00015348 1.69731 zinc ion binding [GO:0008270]
TCONS_00016160 3.55391 Similarity to hypothetical protein B8J22.030 - Neurospora crassa
TCONS_00016161 2.51892 Uncharacterized protein
TCONS_00016333 3.61053 Uncharacterized protein
TCONS_00016535 2.67911 ATP binding [GO:0005524]; MAP kinase activity [GO:0004707]
TCONS_00016540 2.82211 chromatin silencing at centromere [GO:0030702]; chromatin silencing by small RNA [GO:0031048]; cytosol [GO:0005829]; nuclear RNA-directed RNA polymerase complex [GO:0031380]
TCONS_00016744 3.07857 salicylate 1-monooxygenase activity [GO:0018658]
TCONS_00016996 2.13033 nucleus [GO:0005634]
TCONS_00017144 2.31263 alpha,alpha-trehalose-phosphate synthase (UDP-forming) activity [GO:0003825]; trehalose biosynthetic process [GO:0005992]
TCONS_00017687 4.21331 NA
TCONS_00017690 3.34389 catalytic activity [GO:0003824]
TCONS_00018081 3.16574 Putative uncharacterized protein
TCONS_00018181 1.82878 ATP binding [GO:0005524]; cation-transporting ATPase activity [GO:0019829]; copper ion binding [GO:0005507]; integral component of membrane [GO:0016021]; metal ion transport [GO:0030001]
TCONS_00018396 2.6451 hydrolase activity [GO:0016787]
TCONS_00019399 2.12223 Putative uncharacterized protein
TCONS_00019648 1.56032 protein folding [GO:0006457]
TCONS_00019665 2.65388 oxidoreductase activity [GO:0016491]
TCONS_00019893 3.73352 carbohydrate metabolic process [GO:0005975]; glucosamine-6-phosphate deaminase activity [GO:0004342]; hydrolase activity [GO:0016787]; N-acetylglucosamine metabolic process [GO:0006044]
TCONS_00020152 1.72844 Putative uncharacterized protein An16g06890
TCONS_00021022 2.19791 oxidoreductase activity [GO:0016491]
TCONS_00021365 1.57926 aminoacyl-tRNA hydrolase activity [GO:0004045]; mitochondrial translation [GO:0032543]; mitochondrion [GO:0005739]
TCONS_00021491 5.06553 Putative uncharacterized protein
TCONS_00021557 2.40416 Uncharacterized protein
TCONS_00021953 2.34414 Putative uncharacterized protein
TCONS_00022420 2.18167 peptidyl-lysine modification to peptidyl-hypusine [GO:0008612]; ubiquitin-dependent protein catabolic process [GO:0006511]; ubiquitinyl hydrolase activity [GO:0036459]; zinc ion binding [GO:0008270]
TCONS_00022683 2.41099 FMN binding [GO:0010181]; oxidoreductase activity [GO:0016491]
TCONS_00022948 2.13362 'de novo' NAD biosynthetic process from tryptophan [GO:0034354]; anthranilate metabolic process [GO:0043420]; cytoplasm [GO:0005737]; kynureninase activity [GO:0030429]; pyridoxal phosphate binding [GO:0030170]; quinolinate biosynthetic process [GO:0019805]; tryptophan catabolic process [GO:0006569]
TCONS_00023283 3.07009 geranyltranstransferase activity [GO:0004337]; isoprenoid biosynthetic process [GO:0008299]
TCONS_00023303 1.78778 oxidoreductase activity [GO:0016491]; zinc ion binding [GO:0008270]
TCONS_00023471 2.08073 Uncharacterized protein
TCONS_00024067 2.06303 catalase activity [GO:0004096]; heme binding [GO:0020037]; hydrogen peroxide catabolic process [GO:0042744]; metal ion binding [GO:0046872]; response to oxidative stress [GO:0006979]
TCONS_00024575 1.61722 Putative uncharacterized protein
TCONS_00024658 3.98891 FMN binding [GO:0010181]; oxidoreductase activity [GO:0016491]
TCONS_00024703 3.59744 Uncharacterized protein
TCONS_00024873 5.0503 oxidoreductase activity [GO:0016491]
TCONS_00025139 2.41547 cysteine dioxygenase activity [GO:0017172]; iron ion binding [GO:0005506]; L-cysteine metabolic process [GO:0046439]
TCONS_00025239 2.0877 Putative uncharacterized protein
TCONS_00025375 1.84807 Uncharacterized protein
TCONS_00025490 1.99364 DNA binding [GO:0003677]; nucleus [GO:0005634]; sequence-specific DNA binding RNA polymerase II transcription factor activity [GO:0000981]; zinc ion binding [GO:0008270]
TCONS_00026127 1.54131 oxidoreductase activity [GO:0016491]; zinc ion binding [GO:0008270]
TCONS_00026217 2.41116 alcohol metabolic process [GO:0006066]; aryl-alcohol oxidase activity [GO:0047682]; choline dehydrogenase activity [GO:0008812]; flavin adenine dinucleotide binding [GO:0050660]
TCONS_00026458 2.78589 Similarity to hypothetical protein encoded by An13g03400 - Aspergillus niger
TCONS_00027415 2.91504 Uncharacterized protein
TCONS_00027418 2.6692 dihydroxy-acid dehydratase activity [GO:0004160]
TCONS_00027435 4.51776 integral component of membrane [GO:0016021]; transmembrane transport [GO:0055085]
TCONS_00027458 4.14266 Uncharacterized protein
TCONS_00027480 3.31146 Putative uncharacterized protein (Fragment)
TCONS_00027508 2.50547 hydrolase activity [GO:0016787]
TCONS_00027565 2.56677 acetylcholinesterase activity [GO:0003990]
TCONS_00027601 3.32302 Uncharacterized protein
TCONS_00028242 1.5549 oxidoreductase activity [GO:0016491]
TCONS_00028283 2.00877 Uncharacterized protein
TCONS_00028624 3.02476 peroxidase activity [GO:0004601]
TCONS_00029428 1.61041 proline catabolic process [GO:0006562]; proline dehydrogenase activity [GO:0004657]
TCONS_00029510 2.90737 integral component of membrane [GO:0016021]; substrate-specific transmembrane transporter activity [GO:0022891]
TCONS_00029533 2.57207 transferase activity, transferring acyl groups other than amino-acyl groups [GO:0016747]
TCONS_00029875 2.20558 4-hydroxyphenylpyruvate dioxygenase activity [GO:0003868]; aromatic amino acid family metabolic process [GO:0009072]; metal ion binding [GO:0046872]
TCONS_00030202 1.95036 Uncharacterized protein
TCONS_00030226 2.54413 Putative uncharacterized protein (Fragment)
TCONS_00030227 2.09384 30kD heat shock protein
TCONS_00030234 2.03042 Similarity to p45 NF-E2 related factor 2 NRF2 - Mus musculus
TCONS_00030287 1.75066 integral component of membrane [GO:0016021]; transmembrane transport [GO:0055085]
TCONS_00030952 1.53832 catalytic activity [GO:0003824]
TCONS_00031474 3.53484 cinnamyl-alcohol dehydrogenase activity [GO:0045551]; coenzyme binding [GO:0050662]; sinapyl alcohol dehydrogenase activity [GO:0052747]
TCONS_00031680 2.50371 Uncharacterized protein
TCONS_00032017 2.42481 integral component of membrane [GO:0016021]; transmembrane transport [GO:0055085]
TCONS_00032427 2.7443 Similarity to hypothetical protein encoded by An04g01250 - Aspergillus niger
TCONS_00033241 1.6755 Putative uncharacterized protein
TCONS_00033826 1.84979 Similarity to hypothetical protein F28J15.5 -Arabidopsis thaliana
TCONS_00034078 3.41099 ATP binding [GO:0005524]; protein kinase activity [GO:0004672]
TCONS_00034132 1.97209 carbohydrate metabolic process [GO:0005975]; hydrolase activity, hydrolyzing O-glycosyl compounds [GO:0004553]
TCONS_00034159 2.84465 oxidoreductase activity [GO:0016491]; zinc ion binding [GO:0008270]
TCONS_00035340 3.50192 Uncharacterized protein
TCONS_00035343 6.24222 hydrolase activity [GO:0016787]

Appendicx 2.

Genes downregulated under microgravity at 12 hours (Yesupatham, 2015)

Transcript_ID (Query) log2 (fold change) Gene Ontology (GO)
TCONS_00000763 -1.77449 oxidoreductase activity [GO:0016491]
TCONS_00005834 -4.22654 alcohol metabolic process [GO:0006066]; choline dehydrogenase activity [GO:0008812]; flavin adenine dinucleotide binding [GO:0050660]
TCONS_00006565 -1.75678 serine-type endopeptidase activity [GO:0004252]
TCONS_00008115 -3.52938 cyanide hydratase activity [GO:0030196]; hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds [GO:0016810]; nitrogen compound metabolic process [GO:0006807]
TCONS_00008424 -1.65133 cis-stilbene-oxide hydrolase activity [GO:0033961]
TCONS_00010038 -1.9984 oxidoreductase activity [GO:0016491]
TCONS_00010629 -1.51757 endoplasmic reticulum [GO:0005783]; fatty acid biosynthetic process [GO:0006633]; heme binding [GO:0020037]; integral component of membrane [GO:0016021]; iron ion binding [GO:0005506]; stearoyl-CoA 9-desaturase activity [GO:0004768]
TCONS_00012856 -2.21175 Uncharacterized protein
TCONS_00012920 -2.64045 Uncharacterized protein
TCONS_00014757 -1.76938 Putative uncharacterized protein
TCONS_00014965 -1.81078 Similarity to Penicillium decumbens epoxidation enzyme patent JP08322560-A
TCONS_00016002 -1.43464 inorganic phosphate transmembrane transporter activity [GO:0005315]; membrane [GO:0016020]; phosphate ion transport [GO:0006817]
TCONS_00016068 -2.20911 Similarity to hypothetical protein encoded by An07g00010 - Aspergillus niger
TCONS_00016566 -2.2618 hydroxymethylglutaryl-CoA synthase activity [GO:0004421]; isoprenoid biosynthetic process [GO:0008299]
TCONS_00016730 -2.30296 copper ion transmembrane transporter activity [GO:0005375]; integral component of membrane [GO:0016021]
TCONS_00018256 -1.40081 Uncharacterized protein
TCONS_00019501 -2.43191 ATP hydrolysis coupled proton transport [GO:0015991]; hydrogen ion transmembrane transporter activity [GO:0015078]; integral component of membrane [GO:0016021]; proton-transporting V-type ATPase, V0 domain [GO:0033179]
TCONS_00020223 -2.03137 glycerol-3-phosphate transmembrane transporter activity [GO:0015169]; glycerophosphodiester transmembrane transporter activity [GO:0001406]; integral component of membrane [GO:0016021]; plasma membrane
TCONS_00020424 -1.54032 catalytic activity [GO:0003824]; coenzyme binding [GO:0050662]
TCONS_00020563 -2.15568 Uncharacterized protein
TCONS_00021099 -2.19853 oxalate metabolic process [GO:0033609]; oxaloacetase activity [GO:0030603]
TCONS_00022143 -1.39775 lysophospholipase activity [GO:0004622]
TCONS_00025588 -1.90677 hydrolase activity, acting on glycosyl bonds [GO:0016798]
TCONS_00025873 -1.49281 Uncharacterized protein
TCONS_00026519 -1.53012 Uncharacterized protein
TCONS_00027143 -1.92472 Uncharacterized protein
TCONS_00030300 -1.43322 oxidoreductase activity [GO:0016491]
TCONS_00030504 -1.68211 flavin adenine dinucleotide binding [GO:0050660]; UDP-N-acetylmuramate dehydrogenase activity [GO:0008762]
TCONS_00031883 -2.14626 Uncharacterized protein (Fragment)
TCONS_00032943 -1.80275 integral component of membrane [GO:0016021]; transmembrane transport [GO:0055085]
TCONS_00033337 -1.35045 hydrolase activity, acting on ester bonds
TCONS_00035098 -3.2048 carboxymethylenebutenolidase activity