Journal of Environmental Science International
[ SHORT COMMUNICATION ]
Journal of Environmental Science International - Vol. 34, No. 9, pp.557-562
ISSN: 1225-4517 (Print) 2287-3503 (Online)
Print publication date 30 Sep 2025
Received 03 Sep 2025 Revised 11 Sep 2025 Accepted 17 Sep 2025
DOI: https://doi.org/10.5322/JESI.2025.34.9.557

한국 미분포종인 다색캥거루잎벌레(Sagra femorata)의 최초 발견

차민지 ; 강태화1) ; 장범준 ; 백인성 ; 엄순재 ; 조영호 ; 이흥식2) ; 안정섭*
국립생태원 외래생물팀
1)전남바이오진흥원
2)농림축산검역본부 식물방제과
First Report of the Not-Distributed Species Sagra femorata in Korea
Min-Ji Cha ; Tae Hwa Kang1) ; Beom-Jun Jang ; In-Seong Back ; Soon-Jae Eum ; Youngho Cho ; Heung Sik Lee2) ; Jeongseop An*
Invasive Alien Species Team, National Institute of Ecology, Seocheon 33657, Korea
1)Eco-Friendly Agro-Bio Research Center, Jeonnam Bio Foundation, Gokseong 57509, Korea
2)Plant Pest Control Divsion, Animal and Plant Quarantine Agency, Gimcheon 39660, Korea

Correspondence to: *Jeongseop An, Invasive Alien Species Team, National Institute of Ecology, Seocheon 33657, Korea Phone:+82-41-950-5807 E-mail: Jeongseop@nie.re.kr

ⒸThe Korean Environmental Sciences Society. All rights reserved.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

We rapidly report the frog-legged beetle, Sagra femorata, distributed in Southeast Asia was detected in Yeosu, Korea. We confirmed as Sagra femorata in South Korea through subsequent field surveys in Yeosu at July and August, 2025, after a citizen scientist's discover at July, 2025. A total of four individuals were collected from the stems and leaves of Pueraria lobata, and species identification was confirmed by DNA barcoding analysis of the COI gene. The obtained sequences showed the highest similarity to specimens previously collected from international vessels arriving in South Korea from China. Therefore, we proposed the biological references for the invasive species, Sagra femorata for a detailed monitoring. Finally, we suggest that a urgent monitoring is needed to determine whether this invasive species is occurring in Korea.

Keywords:

Invasive species, Sagra femorata, Not-distributed species

1. 서 론

국제 무역과 여행의 증가로 인해 많은 생물들이 본래의 서식지를 벗어나 의도적 또는 비의도적으로 새로운 지역으로 이동하고 있다. 한국의 경우 주요 유입 경로는 컨테이너와 선박을 포함한 항만이며, 이러한 이동은 외래생물의 유입 위험을 높이고 있다(Lim and Ahn, 2020). 실제로 국내 항구 내에서 처리되는 물동량은 2013년 24,590,913 TEU에서 2023년 29,980,184 TEU로 약 21.9% 증가하였으며(BPA, 2025), 외래생물의 유입 종수도 2009년 894종에서 2021년 2,653종으로 급격하게 증가하였다(Kim et al., 2021).

이러한 외래생물의 유입에 대응하기 위해 환경부(국립생태원)는 외래생물 신고센터를 운영하고 있으며, 시민 제보를 기반으로 외래생물 조기 발견과 차단이 이루어지고 있다. 시민 제보에 의해 대만집흰개미(Coptotermes formosanus), 아시아집흰개미(C. gestroi), Tetraponera rufonigra 등이 유입 초기 단계에서 발견되어 국내 정착을 방지할 수 있었다(An et al., 2024; Cha et al., 2025; Jang et al., 2025).

다색캥거루잎벌레(Sagra femorata)는 시민 관찰자에 의해 2025년 7월 29일 유튜브를 통해 한국에서의 발견이 공개되었다. 해당 종은 검역 과정이나 국내로 입항한 국제 선박 내에서 발견된 기록 이외에 확인된 사례는 없다(Lee et al., 2016; Kang et al., 2023; Kang et al., 2024). 현재 본 종은 식물방역법에서 규제병해충 지정 고시를 통해 관리병해충으로 지정되어 있으며(QIA, 2025), 국립생물자원관에서는 ‘국가지정 주요 관리대상 생물종의 국명, 영명 부여’ 사업을 통해 다색캥거루잎벌레라는 국명을 제시하였다(NIBR, 2018).

다색캥거루잎벌레는 동남아시아에 널리 분포하며(Sekerka and Geiser, 2016), 일본과 대만에서 침입 사례가 보고된 바가 있다(Akita et al., 2011; Lee, 2015; Fig. 1). 주요 기주는 콩과(Fabaceae) 식물로 알려져 있으며, 일본에서는 칡(Pueraria lobata) (Akita et al., 2011; Katsuki et al., 2014; Katsuki et al., 2024), 중국에서는 Pueraria thomsonii 에서 피해가 확인되었다(Li et al., 2013). 유충은 줄기 내 목질부와 형성층을 가해하고 일부는 뿌리에 침입하여 피해를 주기도 하며, 마과(Dioscoreaceae)와 같은 다른 과 식물에도 영향을 줄 수 있는 것으로 보고되었다(Sun et al., 2006; Li et al., 2013). 이에 따라, 칡을 포함하는 콩과 및 마과 식물 등 다양한 기주를 가해할 수 있는 다색캥거루잎벌레가 국내에 정착할 경우 생태적·경제적 피해 가능성이 있는 것으로 사료된다. 따라서, 본 연구를 통해 다색캥거루잎벌레의 살아 있는 개체를 과학적 진단을 통해 검증하여 보고하며, 향후 국내 침입 현황 평가 및 관리 대책 수립을 위한 기초 자료를 제공하고자 한다.

Fig. 1.

Global distribution of S. femorata. Red dots indicate previously reported occurrence records obtained from GBIF (GBIF, 2025), whereas the yellow-highlighted area represents the region where S. femorata has been newly reported in South Korea (Yeosu).


2. 재료 및 방법

다색캥거루잎벌레가 촬영된 여수 지역에 국립생태원과 농림축산검역본부는 현장 조사를 실시하였다(Fig. 2). 조사는 2025년 7월 31일부터 8월 1일(4시간), 그리고 8월 6일(2시간) 두 차례에 걸쳐 이루어졌으며, 대상 지역을 중심으로 육안 탐색과 채집이 수행되었다. 다색캥거루잎벌레는 칡을 기주로 하는 것으로 알려져 있어(Akita et al., 2011), 칡을 중심으로 조사를 실시하였다.

Fig. 2.

General view of the survey site.

조사 지점은 낮은 구릉의 기슭에 위치한 완만한 경사지로, 주로 칡과 같은 초본류가 우점하고 있었다. 개활지 형태의 나지로, 한쪽에는 다른 지점에서 옮겨온 것으로 보이는 모래와 바위가 쌓여 있었다. 조사 지점 인근에 도로가 인접해 있으며, 인가는 없었으나 물류창고와 소규모 공장이 위치해 있다(Fig. 2).

채집된 개체는 종 동정을 위해 DNA 추출 실시하였으며, 미토콘트리아 COI 유전자를 타겟으로 하는 프라이머를 사용하였고(Table 1; Folmer et al., 1994), COI의 어닐링(annealing) 온도는 47°C로 설정하였다. DNA sequencing은 ㈜마크로젠(Macrogen, Inc., Korea, Seoul)을 통해 진행하였으며, NCBI에서 BLAST하여 종을 확인하였다. 채집한 샘플들의 염기서열과 NCBI에 등록된 다색캥거루잎벌레의 염기서열 간의 거리를 비교해보기 위해 MEGA7을 이용하여 염기서열 간의 pairwise distance와 계통수를 계산하였으며, 계통수는 Tamura 3-parameter distance(T92) 모델을 기반으로 한 최대우도법(Maximum Likelihood method)으로 작성하였다(Tamura, 1992; Kumar et al., 2016).

Oligonucleotide primers used for the amplification and sequencing of termite Cytochrome Oxidase I


3. 결과 및 고찰

시민 관찰자가 언급한 다색캥거루잎벌레의 최초 발견지인 한국 여수 지역을 대상으로 예찰조사를 실시한 결과, 2025년 7월 31일과 8월 1일(4시간 조사)에는 3개체, 8월 5일(2시간 조사)에는 1개체, 총 4개체가 확인되었으며(Fig. 3), 모두 조사 지점 내 전봇대를 타고 올라간 칡의 목질화된 줄기 및 칡 잎에서 확인되었다(Fig. 2). 주변 칡 덩굴과 인근지역 등을 조사하였으나 추가 개체가 발견되지 않았다. 발견 지점의 생태경관은 칡을 포함한 초본류가 우점하는 개활지 형태의 나지였으며, 공사로 인한 차량 이동 흔적과 외부에서 옮겨진 모래와 바위가 쌓여 있는 등 인위적인 교란 흔적이 관찰되었다. 식생은 이제 막 천이가 시작되는 초기 단계 모습을 보였다.

Fig. 3.

S. femorata : (a) on lignified of P. lobata ; (b) dorsal habitus.

채집된 개체들의 COI 유전자 염기서열은 NCBI의 BLAST 분석 결과 모두 다색캥거루잎벌레와 일치하는 결과를 얻었다(Table 2).

Percent identity (Per. Identity, %) between collected samples (Sample 1–4) and S. femorata COI sequences registered in NCBI

T92 모델을 적용하여 계산한 결과, Sample 1-4의 COI 염기서열 간 Pairwise Distance 값은 0으로 모든 샘플이 동일한 Haplotype임을 확인하였다. 반면 BLAST 시 Sample 1-4와 99.47-99.58%의 유사도를 보였던 PV204311, PV172124, MK049874는 Sample 1-4와 Pairwise Distance 값이 0.003로 나타났으며, 이들 서열 간에도 동일하게 0.003의 차이를 보였다. BLSAT와 Pairwise Distance 결과, PV204311, PV172124, MK049874에서 가장 높은 유사도가 확인되었다(Table 2; Fig. 4). PV204311, PV172124는 각각 중국에서 여수와 부산으로 입항한 국제 선박에서 채집된 기록과 관련이 있으며, MK049874는 중국에서 채집된 개체이다(Nie et al., 2019). 이러한 결과는 초위성체 분석 등의 정밀한 분자생물학적 방법을 통한 검증이 필요할 수 있으나, 앞선 사례(Kang et al., 2023; Kang et al., 2024)와 함께 현재까지의 결과만으로 볼 때, 이번에 확인된 개체들이 중국으로부터 유입되었을 가능성을 시사한다.

Fig. 4.

Maximum likelihood phylogenetic tree with 1,000 bootstrap replications.

이번 조사를 통해 확인된 점 중 하나로 조사 지점이 항구 인근에 위치하고 있다는 점을 고려할 때, 수입 컨테이너에 편승하여 비의도적으로 국내에 유입되었을 가능성이 있다. 실제로 본 종은 2012~2014년 검역 과정에서 확인된 바가 있으며(Lee et al., 2016), 2021년과 2022년에 중국에서 부산과 여수로 입항한 선박에서 내에서 발견된 사례가 보고된 바 있다(Kang et al., 2023; Kang et al., 2024). 본 조사에서는 4개체만이 확보되어 개체군의 이동 경로나 국내 정착 여부를 명확히 규명하기는 어려웠다. 그럼에도 불구하고 본 연구는 국내 미분포종인 다색캥거루잎벌레가 국내에 발생 및 정착이 완료되기 전 확인된 사례라는 점에서 침입생물의 방제 전략적으로 중요한 의의를 가진다. 본 종은 동남아시아에서 주로 분포하는 만큼, 국내 정착 가능성을 판단하기 위해서는 월동 여부가 주요한 관건이다. 이에 따라, 본 연구를 통해, 다색캥거루잎벌레의 발생, 정착 및 확산여부 평가를 위한 잠재적 서식 가능 지역에 대한 지속적인 예찰을 제안하고자 하며, 본 침입종의 방제 대책 및 정책 수립을 위한 기초자료를 제공하고자 한다.

Acknowledgments

본 연구는 환경부의 지원으로 국립생태원 붉은불개미 등 위해 외래생물 예찰 및 신고센터(NIE-C-2025-32)로 수행되었습니다.

References

  • An, J., Song, J., Jang, B. J., Kim, M., Cha, M. J., Eum, S. J., 2024, Recent detection of an invasive termite species Coptotermes formosanus, PNIE, 5(3), 94-98.
  • Animal and Plant Quarantine Agency (QIA), 2025, Plant quarantine in Korea. Plant pest information, regulated insect species, https://www.qia.go.kr/plant/pest/plant_insec_rule.jsp, .
  • Akita, K., Otobe, H., Suzuki, T., Nakanishi, M., Takakuwa, M., 2011, Sagra femorata come to stay in Mie Prefecture, Japan, Gekkan-mushi, 485(36), e43.
  • Busan Port Authority, 2025, Container statistics: export/import and transshipment volumes at Busan Port, 2025, https://www.busanpa.com/kor/Contents.do?mCode=MN1004, .
  • Cha, M. J., Kim, M., Jang, B. J., Choi, Y. S., An, J., 2025, Detection of the Asian Subterranean Termite (Coptotermes gestroi) in South Korea and a reporting-based management system, J. Environ. Sci. Int., 34(5), 289-295. [https://doi.org/10.5322/JESI.2025.34.5.289]
  • Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994, DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates, Mol. Mar. Biol. Biotechnol., 3, 294–299.
  • GBIF (Global Biodiversity Information Facility), 2025, GBIF Occurrence Download, Accessed via QGIS on September 2, 2025, https://www.gbif.org, .
  • Jang, B. J., Cha, M. J., Kim, M., An, J., 2025, First detection of the stowaway Tetraponera rufonigra (Hymenoptera: Formicidae) in South Korea, PNIE, 6(2), 62-64.
  • Kang, T. H., Kim, N. H., Kim, S. W., Choi, D. S., 2023, Alien hitchhiker insect species detected from the international vessels entering into Korea in 2021, JSR, 12(2), 189-196.
  • Kang, T. H., Kim, S. W., Choi, D. S., 2024, Alien hitchhiker insect species detected from international vessels entering Korea in 2022, PNIE, 5(2), 60-67.
  • Katsuki, M., Yokoi, T., Funakoshi, K., Oota, N., 2014, Enlarged hind legs and sexual behavior with male-male interaction in Sagra femorata (Coleoptera: Chrysomelidae), Entomol. News., 124(3), 211-220. [https://doi.org/10.3157/021.124.0306]
  • Katsuki, M., Uesugi, K., Yokoi, T., Ozawa, T., O'Brien, D. M., Emlen, D. J., Okada, K., Okada, Y., 2024, Morphological and functional analyses for investigation of sexually selected legs in the frog legged beetle Sagra femorata (Coleoptera: Chrysomelidae), Arthropod Struct. Dev., 80, 101360. [https://doi.org/10.1016/j.asd.2024.101360]
  • Kim, S., Lee, H., Kim, D., Park, J., Lee, J., Kim, N., Kim, Y., Park, J., Baek, H., Jang, H., Jung, M., Choi, D., Woo, S., Lee, S., Cho, S., Kim, D., Kim, H., Park, E., Ban, Y., Son, M., Lee, J., Jang, B., Chae, D., Shin, J., Song, H., 2021, Information for the field management of invasive alien species in Korea, Ministry of Environment, National Institute of Ecology, Seocheon, Korea.
  • Kumar, S., Stecher, G., Tamura, K., 2016, MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger dataseta, Mol. Biol. Evol., 33(7), 1870-1874. [https://doi.org/10.1093/molbev/msw054]
  • Lee, C. F., 2015, New records of an alien species, Sagra femorata (Drury, 1773), in Taiwan (Coleoptera: Chrysomelidae: Sagrinae), Jpn. J. Syst. Entomol., 21(2), 269-270.
  • Lee, W., Lee, Y., Kim, S., Lee, J. H., Lee, H., Lee, S., Hong, K. J., 2016, Current status of exotic insect pests in Korea: Comparing border interception and incursion during 1996-2014, J. Asia-Pac. Entomol., 19(4), 1095-1101. [https://doi.org/10.1016/j.aspen.2016.09.003]
  • Lim, J. J., Ahn, W. C., 2020, A Study on the improvement of domestic alien species management system, JSL, 36(4), 555-575.
  • Li, Q., Chen, F., Hu, Y. C., Tang, W., Wang, C. J., Zhou, Z. M., Gu, Z. C., 2013, Harm of Sagra femorata to Kudzuvine root in Xiangxi, Journal of Jishou University (Natural Sciences Edition), 34(1), 93.
  • National Institute of Biological Resources (NIBR), 2018, Assignment of Korean and English names for nationally designated key management species: Final report, Report, Northeast Asia Biodiversity Research Institute [in Korea], Incheon, Korea.
  • Nie, R. E., Andújar, C., Gómez‐Rodríguez, C., Bai, M., Xue, H. J., Tang, M., Yang, C. T., Tang, P., Yang, X. K., Vogler, A. P., 2020, The phylogeny of leaf beetles (Chrysomelidae) inferred from mitochondrial genomes, Syst. Entomol., 45(1), 188-204. [https://doi.org/10.1111/syen.12387]
  • Sekerka, L., Geiser, M., 2016, Sagrinae of Laos (Coleoptera: Chrysomelidae), Entomologica Basiliensia et Collectionis Frey, 35, 443-453.
  • Sun, J. H., Liu, Z. D., Britton, K. O., Cai, P., Orr, D., Hough-Goldstein, J., 2006, Survey of phytophagous insects and foliar pathogens in China for a biocontrol perspective on kudzu, Pueraria montana var. lobata (Willd.) Maesen and S. Almeida (Fabaceae), Biol. Control., 36(1), 22-31. [https://doi.org/10.1016/j.biocontrol.2005.09.007]
  • Tamura, K., 1992, Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+ C-content biases, Mol. Biol. Evol., 9(4), 678-687.
∙ Researcher. Min-Ji Cha

Invasive Alien Species Team, National Institute of Ecologycha12311@nie.re.kr

∙ Team Leader. Tae Hwa Kang

Eco-Friendly Agro-Bio Research Center, Jeonnam Bio Foundationcolkth@daum.net

∙ Researcher. Beom-Jun Jang

Invasive Alien Species Team, National Institute of Ecologyjbj2729@nie.re.kr

∙ Researcher. In-Seong Back

Invasive Alien Species Team, National Institute of Ecologyis6630@nie.re.kr

∙ Researcher. Soon-Jae Eum

Invasive Alien Species Team, National Institute of Ecologysoon84@nie.re.kr

∙ Team Leader. Youngho Cho

Invasive Alien Species Team, National Institute of Ecologythemoth@nie.re.kr

∙ Senior Research. Heung Sik Lee

Plant Pest Control Divsion, Animal and Plant Quarantine Agencyhymjkk@dongnam.ac.kr

∙ Associate Researcher. Jeongseop An

Invasive Alien Species Team, National Institute of Ecologyjeongseop@nie.re.kr

Fig. 1.

Fig. 1.
Global distribution of S. femorata. Red dots indicate previously reported occurrence records obtained from GBIF (GBIF, 2025), whereas the yellow-highlighted area represents the region where S. femorata has been newly reported in South Korea (Yeosu).

Fig. 2.

Fig. 2.
General view of the survey site.

Fig. 3.

Fig. 3.
S. femorata : (a) on lignified of P. lobata ; (b) dorsal habitus.

Fig. 4.

Fig. 4.
Maximum likelihood phylogenetic tree with 1,000 bootstrap replications.

Table 1.

Oligonucleotide primers used for the amplification and sequencing of termite Cytochrome Oxidase I

Target gene Name Sequence (5' -> 3') Product size
COⅠ LCO1490 GGTCAACAAATCATAAAGATATTGG 658bp
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA

Table 2.

Percent identity (Per. Identity, %) between collected samples (Sample 1–4) and S. femorata COI sequences registered in NCBI

Species Common name Sample 1 Sample 2 Sample 3 Sample 4 Accession No.
Sagra femorata Kangaroo beetle 99.52% 99.47% 99.58% 99.58% PV204311
99.52% 99.47% 99.58% 99.58% PV172124
99.52% 99.47% 99.58% 99.58% MK049874
95.22% 95.91% 96.43% 96.43% MT554387